ID: 1152049219_1152049240

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1152049219 1152049240
Species Human (GRCh38) Human (GRCh38)
Location 17:77959198-77959220 17:77959247-77959269
Sequence CCGCCGCCGCCGCCAGGCCCGCG CGCCGCCGGGGACGGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 199, 4: 1297} {0: 1, 1: 0, 2: 1, 3: 32, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!