ID: 1152049221_1152049235

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152049221 1152049235
Species Human (GRCh38) Human (GRCh38)
Location 17:77959204-77959226 17:77959235-77959257
Sequence CCGCCGCCAGGCCCGCGCCACCG CGGAGCCGCCGCCGCCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 714} {0: 2, 1: 7, 2: 126, 3: 303, 4: 806}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!