ID: 1152053967_1152053972

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1152053967 1152053972
Species Human (GRCh38) Human (GRCh38)
Location 17:78007198-78007220 17:78007247-78007269
Sequence CCTTCTATATCCTCTAAAATACT ACTACTAACTAGCCTTAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 256} {0: 1, 1: 0, 2: 1, 3: 11, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!