ID: 1152061564_1152061571

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152061564 1152061571
Species Human (GRCh38) Human (GRCh38)
Location 17:78079765-78079787 17:78079798-78079820
Sequence CCTCAGCCACCGAAACTAGCATT CTGGTCAGAAGCAATATTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136} {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!