ID: 1152066366_1152066374

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1152066366 1152066374
Species Human (GRCh38) Human (GRCh38)
Location 17:78114821-78114843 17:78114863-78114885
Sequence CCGACAGCCCCAAAGACGGGTCA CACCACAGCCAGCATCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 85} {0: 1, 1: 0, 2: 0, 3: 16, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!