ID: 1152079577_1152079588

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152079577 1152079588
Species Human (GRCh38) Human (GRCh38)
Location 17:78178383-78178405 17:78178435-78178457
Sequence CCTGTGTGTCTCGCCCGGGGTAC CCTTCCTCAGGATGGCACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} {0: 1, 1: 0, 2: 0, 3: 20, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!