ID: 1152081631_1152081641

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1152081631 1152081641
Species Human (GRCh38) Human (GRCh38)
Location 17:78191073-78191095 17:78191115-78191137
Sequence CCTCTCCGTGGCCGCATTGGGTG GATTCAGAATGCTGGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} {0: 1, 1: 1, 2: 1, 3: 30, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!