ID: 1152083407_1152083415

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1152083407 1152083415
Species Human (GRCh38) Human (GRCh38)
Location 17:78202799-78202821 17:78202828-78202850
Sequence CCCTGGGGGACTCCTCCTCCAGG GCAACCAAACTGCCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271} {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!