|
Left Crispr |
Right Crispr |
| Crispr ID |
1152083554 |
1152083563 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:78203744-78203766
|
17:78203778-78203800
|
| Sequence |
CCAGGTACGGTGGCTCACGCCTG |
CTTTGGAAGGGCAAGGCGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 418, 1: 20445, 2: 93970, 3: 160128, 4: 170987} |
{0: 1, 1: 44, 2: 1747, 3: 28241, 4: 124099} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|