ID: 1152089047_1152089052

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152089047 1152089052
Species Human (GRCh38) Human (GRCh38)
Location 17:78237040-78237062 17:78237056-78237078
Sequence CCCTCTGCATTGTGCCTGGGAGC TGGGAGCGAAGGCACCGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 208} {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!