ID: 1152097816_1152097825

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1152097816 1152097825
Species Human (GRCh38) Human (GRCh38)
Location 17:78282118-78282140 17:78282162-78282184
Sequence CCAGCACTTTGGGAGGCCAAGGC TATCGAGATCAGGCCGGGCACGG
Strand - +
Off-target summary {0: 52775, 1: 164492, 2: 216668, 3: 175886, 4: 111238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!