ID: 1152111368_1152111381

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152111368 1152111381
Species Human (GRCh38) Human (GRCh38)
Location 17:78359359-78359381 17:78359396-78359418
Sequence CCGGCAGGGTGGCCCCGGGCAGC GCACTGCAAGGGCGCAGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 437} {0: 1, 1: 0, 2: 1, 3: 4, 4: 117}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
14 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC - 17:78359396-78359418 GCACTGCAAGGGCGCAGCGTGGG +