ID: 1152114819_1152114832

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1152114819 1152114832
Species Human (GRCh38) Human (GRCh38)
Location 17:78378939-78378961 17:78378981-78379003
Sequence CCTCCCGGGGCTCGGCGCCTGAC CCTTCTTGAGGGAGGGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 125} {0: 1, 1: 0, 2: 4, 3: 70, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!