ID: 1152114824_1152114832

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152114824 1152114832
Species Human (GRCh38) Human (GRCh38)
Location 17:78378961-78378983 17:78378981-78379003
Sequence CCTATGTGCTTCTTCACTGGCCT CCTTCTTGAGGGAGGGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 212} {0: 1, 1: 0, 2: 4, 3: 70, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!