ID: 1152123526_1152123532

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152123526 1152123532
Species Human (GRCh38) Human (GRCh38)
Location 17:78433088-78433110 17:78433113-78433135
Sequence CCATGTCGCTATTGATTTGGAGG GAGAGTGAGGAGGAGGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47} {0: 1, 1: 1, 2: 17, 3: 140, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!