ID: 1152124512_1152124522

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1152124512 1152124522
Species Human (GRCh38) Human (GRCh38)
Location 17:78438257-78438279 17:78438301-78438323
Sequence CCGTGGAAGCTGGGACAGGCCCA TAGTGAGAAGGGGTCTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 330} {0: 1, 1: 0, 2: 2, 3: 12, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!