ID: 1152161877_1152161888

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152161877 1152161888
Species Human (GRCh38) Human (GRCh38)
Location 17:78673999-78674021 17:78674034-78674056
Sequence CCACCTCGAGGGCCCCGCCTGAG GCGAACAACAAAGATGGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145} {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!