ID: 1152171379_1152171382

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152171379 1152171382
Species Human (GRCh38) Human (GRCh38)
Location 17:78751384-78751406 17:78751411-78751433
Sequence CCTCTTGTACTTAGGAACAATAG AAATTCAGCATTATGATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 19, 4: 157} {0: 1, 1: 0, 2: 2, 3: 24, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!