ID: 1152174995_1152175008

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152174995 1152175008
Species Human (GRCh38) Human (GRCh38)
Location 17:78781845-78781867 17:78781885-78781907
Sequence CCCTCAGAGCCCCTGAGATCCTG CCCTCATTCCTCAGAGCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 26, 4: 281} {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!