ID: 1152177384_1152177391

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152177384 1152177391
Species Human (GRCh38) Human (GRCh38)
Location 17:78796762-78796784 17:78796788-78796810
Sequence CCACCTGCGACGACTCCGGGAGG TGACGGGGACAGACCCGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!