ID: 1152182069_1152182073

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152182069 1152182073
Species Human (GRCh38) Human (GRCh38)
Location 17:78828682-78828704 17:78828707-78828729
Sequence CCTACAGGGCGAGCACTTAGCAG CTTCAGTAACAGATGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61} {0: 1, 1: 0, 2: 1, 3: 18, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!