|
Left Crispr |
Right Crispr |
Crispr ID |
1152182204 |
1152182210 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:78829822-78829844
|
17:78829853-78829875
|
Sequence |
CCTCCGCCTGCCGGGTTTAAGCA |
GCCTCAGCCTCCCAAGTGGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 214, 2: 6945, 3: 41384, 4: 107457} |
{0: 1328, 1: 85085, 2: 197090, 3: 302866, 4: 346625} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|