ID: 1152185522_1152185526

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152185522 1152185526
Species Human (GRCh38) Human (GRCh38)
Location 17:78854309-78854331 17:78854322-78854344
Sequence CCCCATATCACTGGCTTCAGGAA GCTTCAGGAAACCACACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 235} {0: 1, 1: 0, 2: 3, 3: 15, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!