ID: 1152201175_1152201177

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152201175 1152201177
Species Human (GRCh38) Human (GRCh38)
Location 17:78947299-78947321 17:78947315-78947337
Sequence CCGGCTTTGGACTCGGCTCCAGC CTCCAGCCAGCTGGTTCTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!