ID: 1152202450_1152202457

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152202450 1152202457
Species Human (GRCh38) Human (GRCh38)
Location 17:78955014-78955036 17:78955047-78955069
Sequence CCTTCATTCATTCAGCAAAGACT CCACGTTCCCACCTGGTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 28, 3: 155, 4: 675} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!