|
Left Crispr |
Right Crispr |
| Crispr ID |
1152217011 |
1152217020 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:79039209-79039231
|
17:79039262-79039284
|
| Sequence |
CCATGTTTGGAGACATTTTTTGT |
CATCTGGTGGGGACAGTCCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 38, 3: 104, 4: 543} |
{0: 1, 1: 0, 2: 10, 3: 102, 4: 698} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|