ID: 1152223394_1152223405

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152223394 1152223405
Species Human (GRCh38) Human (GRCh38)
Location 17:79081656-79081678 17:79081707-79081729
Sequence CCTCTGAGATCTAGGAGGGGAAA GCCCTGTCCCTCTGGGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 258} {0: 1, 1: 0, 2: 4, 3: 48, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!