ID: 1152223573_1152223588

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152223573 1152223588
Species Human (GRCh38) Human (GRCh38)
Location 17:79082383-79082405 17:79082433-79082455
Sequence CCCCGTGAGGGAAGCCTGCGGGG CTGCGGCTCAGGGGCGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 122} {0: 1, 1: 0, 2: 0, 3: 17, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!