ID: 1152223582_1152223588

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152223582 1152223588
Species Human (GRCh38) Human (GRCh38)
Location 17:79082417-79082439 17:79082433-79082455
Sequence CCTGCAGCGCCTCTCACTGCGGC CTGCGGCTCAGGGGCGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 165} {0: 1, 1: 0, 2: 0, 3: 17, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!