ID: 1152227315_1152227324

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1152227315 1152227324
Species Human (GRCh38) Human (GRCh38)
Location 17:79098464-79098486 17:79098507-79098529
Sequence CCCTCCCCATTTTGCAGATGAAG AGCAACCTCCCGTCAGCAGCTGG
Strand - +
Off-target summary {0: 2, 1: 13, 2: 83, 3: 327, 4: 973} {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!