ID: 1152231778_1152231791

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152231778 1152231791
Species Human (GRCh38) Human (GRCh38)
Location 17:79117522-79117544 17:79117553-79117575
Sequence CCCGCTTCCCTCCACACCCACAC CTGCCGGGCTCCTGTGTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 111, 4: 1023} {0: 1, 1: 0, 2: 1, 3: 19, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!