ID: 1152232991_1152232993

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1152232991 1152232993
Species Human (GRCh38) Human (GRCh38)
Location 17:79124290-79124312 17:79124308-79124330
Sequence CCTTCAATCACACAGCAAGGTGA GGTGACCACCATGGCTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183} {0: 1, 1: 0, 2: 2, 3: 27, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!