ID: 1152233891_1152233897

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152233891 1152233897
Species Human (GRCh38) Human (GRCh38)
Location 17:79128530-79128552 17:79128561-79128583
Sequence CCCAGAAACAGGCCACCTCTACA GCTCCTAACTCCAAGGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118} {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!