ID: 1152236819_1152236842

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1152236819 1152236842
Species Human (GRCh38) Human (GRCh38)
Location 17:79143261-79143283 17:79143314-79143336
Sequence CCACCCTGCCTCTGTCCTTACAG TGGGGGACCTGGATATTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 499} {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!