ID: 1152239706_1152239720

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152239706 1152239720
Species Human (GRCh38) Human (GRCh38)
Location 17:79154975-79154997 17:79155012-79155034
Sequence CCCAGCCTCGGCGTCTGAGGAAG CCAGGCATCCAAAGGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 587} {0: 1, 1: 0, 2: 4, 3: 19, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!