ID: 1152251484_1152251488

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152251484 1152251488
Species Human (GRCh38) Human (GRCh38)
Location 17:79214935-79214957 17:79214960-79214982
Sequence CCTTGGCATCTTCGCCTGGTGCC TCAATTATGAAGCCACCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 130} {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!