ID: 1152252354_1152252360

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152252354 1152252360
Species Human (GRCh38) Human (GRCh38)
Location 17:79218656-79218678 17:79218669-79218691
Sequence CCGGGAGCCGAGATGCAGGGAGG TGCAGGGAGGTCAGGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 254} {0: 1, 1: 0, 2: 4, 3: 47, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!