ID: 1152258744_1152258750

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1152258744 1152258750
Species Human (GRCh38) Human (GRCh38)
Location 17:79255204-79255226 17:79255250-79255272
Sequence CCTGTGGTCACATGTGTGCGTGT TGTACTGGGGGTGTGGCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 170} {0: 1, 1: 0, 2: 3, 3: 22, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!