ID: 1152262221_1152262228

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1152262221 1152262228
Species Human (GRCh38) Human (GRCh38)
Location 17:79273390-79273412 17:79273414-79273436
Sequence CCAGGGCTGTGAGAAGGGGAGAG GTGTTTTAGGGTGGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 534} {0: 1, 1: 0, 2: 0, 3: 56, 4: 604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!