ID: 1152264669_1152264676

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1152264669 1152264676
Species Human (GRCh38) Human (GRCh38)
Location 17:79287395-79287417 17:79287412-79287434
Sequence CCTCTTGAGTAGGTTTGCATTGA CATTGAGTGGGGGGTAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99} {0: 1, 1: 1, 2: 11, 3: 15, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!