ID: 1152267480_1152267486

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152267480 1152267486
Species Human (GRCh38) Human (GRCh38)
Location 17:79304770-79304792 17:79304800-79304822
Sequence CCGGGGCCTCTGTTCTTGGTTCC AGATTCTCGGAAGGTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 309} {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!