ID: 1152292427_1152292436

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152292427 1152292436
Species Human (GRCh38) Human (GRCh38)
Location 17:79447729-79447751 17:79447766-79447788
Sequence CCATCCATGTGAGCATTGCTCAG GGCCGTGCTGAGGGGCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 166} {0: 1, 1: 0, 2: 3, 3: 36, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!