ID: 1152294151_1152294157

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1152294151 1152294157
Species Human (GRCh38) Human (GRCh38)
Location 17:79456898-79456920 17:79456926-79456948
Sequence CCTAAATCCCCCAAGTTGTTCTG CAGCACCTGCCCATTCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163} {0: 1, 1: 0, 2: 2, 3: 30, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!