ID: 1152298386_1152298397

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152298386 1152298397
Species Human (GRCh38) Human (GRCh38)
Location 17:79481586-79481608 17:79481631-79481653
Sequence CCCCACCTCAGGGGAGCAGAGAG TGGCTCGGGGAGCTTGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 405} {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!