ID: 1152303541_1152303557

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1152303541 1152303557
Species Human (GRCh38) Human (GRCh38)
Location 17:79508736-79508758 17:79508789-79508811
Sequence CCGCACACCCCACACACCCCGCA CCATGTGTCCCCAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 89, 3: 604, 4: 2264} {0: 1, 1: 0, 2: 6, 3: 63, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!