ID: 1152321509_1152321528

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152321509 1152321528
Species Human (GRCh38) Human (GRCh38)
Location 17:79610728-79610750 17:79610778-79610800
Sequence CCCATGCGCCCCTCCGCGGCCAT GGAATGACCGCCGCAGAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!