ID: 1152321531_1152321541

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152321531 1152321541
Species Human (GRCh38) Human (GRCh38)
Location 17:79610785-79610807 17:79610835-79610857
Sequence CCGCCGCAGAGCGAGGCGGGCGA GCTCCCCGCGGCAGGTGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!