ID: 1152321569_1152321581

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152321569 1152321581
Species Human (GRCh38) Human (GRCh38)
Location 17:79610917-79610939 17:79610950-79610972
Sequence CCGCACAGGCACCGGCGAGCCAG CGCGCGAGGCCGGGCTCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115} {0: 1, 1: 0, 2: 4, 3: 21, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!