ID: 1152321575_1152321583

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152321575 1152321583
Species Human (GRCh38) Human (GRCh38)
Location 17:79610936-79610958 17:79610959-79610981
Sequence CCAGCGGCAAGGGGCGCGCGAGG CCGGGCTCGGGCGGCAGCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!