ID: 1152337886_1152337896

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152337886 1152337896
Species Human (GRCh38) Human (GRCh38)
Location 17:79708273-79708295 17:79708308-79708330
Sequence CCATCACGGGCCTCCCGCAGGAC CAGCTTCCATTGACCAAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114} {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!